p-value: | 1e-58 |
log p-value: | -1.343e+02 |
Information Content per bp: | 1.530 |
Number of Target Sequences with motif | 546.0 |
Percentage of Target Sequences with motif | 0.92% |
Number of Background Sequences with motif | 1759.8 |
Percentage of Background Sequences with motif | 0.39% |
Average Position of motif in Targets | 19.9 +/- 7.8bp |
Average Position of motif in Background | 20.5 +/- 13.5bp |
Strand Bias (log2 ratio + to - strand density) | 10.0 |
Multiplicity (# of sites on avg that occur together) | 1.05 |
Motif File: | file (matrix) reverse opposite |
PDF Format Logos: | forward logo reverse opposite |
hsa-miR-4472 MIMAT0018999 Homo sapiens miR-4472 Targets (miRBase)
Match Rank: | 1 |
Score: | 0.74 |
Offset: | -9 |
Orientation: | forward strand |
Alignment: | ---------CCCCCC--- AAAACAACACCCCCCACC |
|

|
|
hsa-miR-4525 MIMAT0019064 Homo sapiens miR-4525 Targets (miRBase)
Match Rank: | 2 |
Score: | 0.72 |
Offset: | -15 |
Orientation: | forward strand |
Alignment: | ---------------CCCCCC AACCAGCATGCACATCCCCCC |
|

|
|
hsa-miR-3679-3p MIMAT0018105 Homo sapiens miR-3679-3p Targets (miRBase)
Match Rank: | 3 |
Score: | 0.72 |
Offset: | -3 |
Orientation: | reverse strand |
Alignment: | ---CCCCCC------------- CTTCCCCCCAGTAATCTTCATC |
|

|
|
hsa-miR-4447 MIMAT0018966 Homo sapiens miR-4447 Targets (miRBase)
Match Rank: | 4 |
Score: | 0.68 |
Offset: | -8 |
Orientation: | forward strand |
Alignment: | --------CCCCCC--- AAACAACAGCCCCCACC |
|

|
|
hsa-miR-4278 MIMAT0016910 Homo sapiens miR-4278 Targets (miRBase)
Match Rank: | 5 |
Score: | 0.67 |
Offset: | -9 |
Orientation: | forward strand |
Alignment: | ---------CCCCCC--- CAAGGGCAAACCCCCTAG |
|

|
|
hsa-miR-4488 MIMAT0019022 Homo sapiens miR-4488 Targets (miRBase)
Match Rank: | 6 |
Score: | 0.67 |
Offset: | -12 |
Orientation: | forward strand |
Alignment: | ------------CCCCCC CGCCGGAGCCCGCCCCCT |
|

|
|
hsa-miR-625 MIMAT0003294 Homo sapiens miR-625 Targets (miRBase)
Match Rank: | 7 |
Score: | 0.65 |
Offset: | -15 |
Orientation: | forward strand |
Alignment: | ---------------CCCCCC GGACTATAGAACTTTCCCCCT |
|

|
|
hsa-miR-1275 MIMAT0005929 Homo sapiens miR-1275 Targets (miRBase)
Match Rank: | 8 |
Score: | 0.65 |
Offset: | -9 |
Orientation: | forward strand |
Alignment: | ---------CCCCCC-- GACAGCCTCTCCCCCAC |
|

|
|
hsa-miR-4483 MIMAT0019017 Homo sapiens miR-4483 Targets (miRBase)
Match Rank: | 9 |
Score: | 0.65 |
Offset: | -10 |
Orientation: | forward strand |
Alignment: | ----------CCCCCC- CAACAACAGACCACCCC |
|

|
|
hsa-miR-4258 MIMAT0016879 Homo sapiens miR-4258 Targets (miRBase)
Match Rank: | 10 |
Score: | 0.65 |
Offset: | -1 |
Orientation: | reverse strand |
Alignment: | -CCCCCC---------- CCCCGCCACCGCCTTGG |
|

|
|