p-value: | 1e-15 |
log p-value: | -3.579e+01 |
Information Content per bp: | 1.811 |
Number of Target Sequences with motif | 600.0 |
Percentage of Target Sequences with motif | 7.01% |
Number of Background Sequences with motif | 3512.4 |
Percentage of Background Sequences with motif | 4.88% |
Average Position of motif in Targets | 30.6 +/- 19.9bp |
Average Position of motif in Background | 26.1 +/- 28.9bp |
Strand Bias (log2 ratio + to - strand density) | 10.0 |
Multiplicity (# of sites on avg that occur together) | 1.11 |
Motif File: | file (matrix) reverse opposite |
PDF Format Logos: | forward logo reverse opposite |
hsa-miR-3615 MIMAT0017994 Homo sapiens miR-3615 Targets (miRBase)
Match Rank: | 1 |
Score: | 0.73 |
Offset: | -13 |
Orientation: | forward strand |
Alignment: | -------------KCGAGAG- GAGCCGCGAGGAGCCGAGAGA |
|

|
|
hsa-miR-4523 MIMAT0019061 Homo sapiens miR-4523 Targets (miRBase)
Match Rank: | 2 |
Score: | 0.66 |
Offset: | -2 |
Orientation: | reverse strand |
Alignment: | --KCGAGAG------------ GACCGAGAGGGCCTCGGCTGT |
|

|
|
hsa-miR-4740-3p MIMAT0019870 Homo sapiens miR-4740-3p Targets (miRBase)
Match Rank: | 3 |
Score: | 0.65 |
Offset: | -2 |
Orientation: | reverse strand |
Alignment: | --KCGAGAG------------- GCCCGAGAGGATCCGTCCCTGC |
|

|
|
hsa-miR-516a-5p MIMAT0004770 Homo sapiens miR-516a-5p Targets (miRBase)
Match Rank: | 4 |
Score: | 0.65 |
Offset: | -16 |
Orientation: | forward strand |
Alignment: | ----------------KCGAGAG GAAAGTGCTTCTTTCCTCGAGAA |
|

|
|
hsa-miR-720 MIMAT0005954 Homo sapiens miR-720 Targets (miRBase)
Match Rank: | 5 |
Score: | 0.64 |
Offset: | -11 |
Orientation: | forward strand |
Alignment: | -----------KCGAGAG TGGAGGCCCCAGCGAGA- |
|

|
|
hsa-miR-4798-3p MIMAT0019975 Homo sapiens miR-4798-3p Targets (miRBase)
Match Rank: | 6 |
Score: | 0.64 |
Offset: | -13 |
Orientation: | forward strand |
Alignment: | -------------KCGAGAG-- ACTTCGGTATACTTCGTGAGTT |
|

|
|
hsa-miR-4639-3p MIMAT0019698 Homo sapiens miR-4639-3p Targets (miRBase)
Match Rank: | 7 |
Score: | 0.64 |
Offset: | -10 |
Orientation: | forward strand |
Alignment: | ----------KCGAGAG--- GCAAAGCAAGGTGAGAGTGA |
|

|
|
hsa-miR-1251 MIMAT0005903 Homo sapiens miR-1251 Targets (miRBase)
Match Rank: | 8 |
Score: | 0.62 |
Offset: | -13 |
Orientation: | forward strand |
Alignment: | -------------KCGAGAG- AGCGCCTTTGGCAGCTAGAGT |
|

|
|
hsa-miR-4306 MIMAT0016858 Homo sapiens miR-4306 Targets (miRBase)
Match Rank: | 9 |
Score: | 0.61 |
Offset: | 0 |
Orientation: | reverse strand |
Alignment: | KCGAGAG---------- TGGAGAGAAAGGCAGTA |
|

|
|
hsa-miR-4693-3p MIMAT0019785 Homo sapiens miR-4693-3p Targets (miRBase)
Match Rank: | 10 |
Score: | 0.61 |
Offset: | 1 |
Orientation: | reverse strand |
Alignment: | KCGAGAG----------------- -TGAGAGTGGAATTCACAGTATTT |
|

|
|